Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
mmu_circRNA_003540 | |||
Gene | n/a | Organism | Mouse |
Genome Locus | n/a | Build | n/a |
Disease | Alzheimer's disease | ICD-10 | Alzheimer's disease (G30) |
DBLink | Link to database | PMID | 29448241 |
Experimental Method | |||
Sample Type | Hippocampal Tissues | Comparison | hippocampal tissues of SAMP8 and SAMR1 |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGACTGACGGCTCTGTTCTG ReverseCAATTGTTACCTGCCCCATC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Huang, JL, Qin, MC, Zhou, Y, Xu, ZH, Yang, SM, Zhang, F, Zhong, J, Liang, MK, Chen, B, Zhang, WY, Wu, DP, Zhong, ZG (2018). Comprehensive analysis of differentially expressed profiles of Alzheimer's disease associated circular RNAs in an Alzheimer's disease mouse model. Aging (Albany NY), 10, 2:253-265. |